Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility

doi:10.15541/jim20210125

Abstract

Abstract:

Peri-implantitis can lead to peri-implant attachment loss, bone absorption, and even implant loose or lost. In this study, the atomic layer deposition technique and silanization were applied to prepare a composite zinc oxide (ZnO) /fibronectin (Fn) coating on the surface of titanium (Ti). Peri-implantitis related bacteria, including Aggregatibacter actinomycetemcomitans (A. a) and Porphyromonas gingivalis (P. g), were chosen to evaluate the antibacterial effect of the composite coating. Spreading, proliferation and associated gene expression of human gingival fibroblasts on Ti, Ti/ZnO, and Ti/ZnO/Fn were evaluated. In vivo peri-implantitis model was established on SD rat maxilla through the infusion of mixed bacterial suspension. The peri-implant bone resorption and inflammatory infiltration in gingiva were investigated. The results showed that antibacterial efficacies of the composite coating against A. a and P. g for 24 h were up to 80.9% and 75.7%, respectively. Fibroblasts on the surface of Ti/ZnO/Fn showed adhesion and proliferation in vitro. In the model of peri-implantitis, Micro-CT showed that the amount of peri-implant bone absorption of Ti was (1.14±0.71) mm, while the amount of Ti/ZnO/Fn was only (0.37±0.28) mm. Moreover, the observation of paraffin section and qPCR revealed that inflammation level of gingiva and alveolar bone around Ti was lower in Ti/ZnO/Fn than in other groups. In conclusion, the composite coating for dental implants might be effective on defensing bacterial invasion, enhancing gingiva attachment and preventing inflammation response of gingiva.

Key words: titanium, zinc oxide, fibronectin, peri-implantitis

CLC Number:

TQ174

ZHANG Dawei, ZHU Liyuan, LU Hongliang, WANG Zuolin. Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility[J]. Journal of Inorganic Materials, 2021, 36(12): 1316-1322.

Figures/Tables 10

Fig. 1 (a) Schematic diagram of fabrication progress of Ti/ZnO and Ti/ZnO/Fn, and SEM images of (b, e) Ti, (c, f) Ti/ZnO and (d, g) Ti/ZnO/Fn at low (b-d) and high (e-g) magnification ALD: Atomic layer deposition

Fig. 2 (a) XPS spectra of Ti, Ti/ZnO, and Ti/ZnO/Fn, (b) high-resolution spectra of N1s peak of Ti, Ti/ZnO, Ti/ZnO/APTES, and Ti/ZnO/Fn, and (c) FT-IR spectra of Ti/ZnO/APTES and Ti/ZnO/Fn Ti/ZnO/APTES: Ti disc with ZnO nanofilm modified with APTES

Fig. 3 Antibacterial effects and mechanisms of Ti, Ti/ZnO, and Ti/ZnO/Fn against A. a and P. g for 24 h (a) Typical bacteria colonies of A. a and P. g on Ti, Ti/ZnO, and Ti/ZnO/Fn (left) with average corresponding antibacterial rates (right); (b) Fluorecent images of dead bacteria (red) and total bacteria (green) on surfaces of Ti, Ti/ZnO, and Ti/ZnO/Fn after incubation (left) and their dead/total ratio (right); (c) Cumulative zinc ion release curves of Ti/ZnO and Ti/ZnO/Fn A. a: Aggregatibacter actinomycetemcomitans; P. g: Porphyro-monas gingivalis. The error bars indicate standard deviations. *P < 0.05, **P < 0.01, and ***P < 0.005 (n=3, One-way ANOVA)

Fig. 4 Cytocompatibility of Ti/ZnO/Fn on human gingival fibroblasts (a) Fluorescent images of hGFs cultured on Ti, Ti/ZnO and Ti/ZnO/Fn for 6 and 12 h with vinculin staining (red) and nuclei staining (blue); (b) SEM images of hGFs attachment on Ti, Ti/ZnO and Ti/ZnO/Fn for 6 and 12 h; (c) Quantitative measurement of spreading area of hGFs on Ti, Ti/ZnO and Ti/ZnO/Fn after 6 and 12 h culture; (d) Cell viabilities cultured on Ti, Ti/ZnO and Ti/ZnO/Fn after 1, 3 and 7 d hGFs: human gingival fibroblasts. Error bars indicate standard deviations. **P < 0.01, and ***P < 0.005 (n=3, One-way ANOVA)

Fig. 5 Quantification of the gene expression of (a) Col1, (b) Col3 and (c) ITGB1a in hGFs on Ti, Ti/ZnO and Ti/ZnO/Fn for 3 d by qPCR Data are normalized against reference gene expression of glyceraldehyde- 3-phosphate dehydrogenase and standardized with Ct (cycle threshold) of Ti. Error bars indicate standard deviations. **P < 0.01 and ***P < 0.005 (n=3, One-way ANOVA)

Fig. 6 (a) Sagittal pictures of Micro-CT, (b) H&E-stained tissues around screws, and (c) quantification of the gene expression of IL1β, Arg1, TNFα, IL4, and TGFβ1 by qPCR in gingiva tissues around Ti, Ti/ZnO and Ti/ZnO/Fn screws after being inserted into maxillae of rats for 4 w Data are normalized against reference gene expression of glyceraldehyde-3-phosphate dehydrogenase and standardized with Ct of control. Control: Ti screws infused with bacteria culture medium; Ti, Ti/ZnO and Ti/ZnO/Fn: Ti, Ti/ZnO and Ti/ZnO/Fn screws infused with mixed bacterial suspension. Error bars indicate standard deviations. *P < 0.05, **P < 0.01, and ***P < 0.005 (n=3, One-way ANOVA)

Table S1 Specific forward and reverse primer sequences of detected genes of HGFs

Gene	Forward primer sequence (5′-3′)	Reverse primer sequence (3′-5′)
GAPDH	GCACCGTCAAGGCTGAGAAC	TGGTGAAGACGCCAGTGGA
Col1	TCTAGACATGTTCAGCTTTGTGGAC	TCTGTACGCAGGTGATTGGTG
Col3	GCAAATTCACCTACACAGTTCTGGA	CTTGATCAGGACCACCAATGTCATA
ITGB1α	TGTGTCAGACCTGCCTTGGTG	AGGAACATTCCTGTGTGCATGTG

Table S2 Specific forward and reverse primer sequences of detected genes of rat

Gene	Forward primer sequence (5′-3′)	Reverse primer sequence (3′-5′)
GAPDH	CCCCAATGTATCCGTTGTG	CTCAGTGTAGCCCAGGATGC
IL1β	GACCTGTTCTTTGAGGCTGACA	CTCATCTGGACAGCCCAAGTC
Arg1	AGCAGAGACCCAGAAGAATG	TTTCCTTTCAGTTCCTTCAG
TNFα	GACAAGGCTGCCCCGACTAT	GGGAGACTCCTCCCAGGTACA
IL4	TCGCTTGCCTTGGTGGTC	TGTGATGTTGCTCAGCTCCTC
TGFβ1	AGGACCTGGGTTGGAAGTGG	AGTTGGCATGGTAGCCCTTG

Table S3 Elemental chemical composition of Ti, Ti/ZnO and Ti/ZnO/Fn

Sample	C1s/%	O1s/%	N1s/%	Si2p3/%	Ti2p3/%	Zn2p3/%
Ti	57.69	31.07	1.92	0.02	9.26	0.05
Ti/ZnO	38.94	37.22	2.26	0.08	1.07	20.44
Ti/ZnO/Fn	63.91	21.2	11.88	2.27	0.13	0.6

Fig. S1 Reactive oxygen species (ROS) detected by fluorescence probes in bacteria cultured on materials for 24 h (a) Fluorescent images of ROS in A. a and P. g cultured on Ti/ZnO and Ti/ZnO/Fn; (b) Quantitative measurement of area of ROS in A. a and P. g Error bars indicate standard deviations: *P < 0.05 (n=3, Student’s t test)

References 24

[1]	SIMONIS PIERRE, DUFOUR THOMAS, TENENBAUM HENRI. Long-term implant survival and success: a 10-16-year follow-up of non-submerged dental implants. Clin. Oral Implants Res., 2010, 21(7): 772-777. DOI URL
[2]	DIXON DOUGLAS R, LONDON ROBERT M. Restorative design and associated risks for peri-implant diseases. Periodontol 2000, 2019, 81(1): 167-178. DOI URL
[3]	DAUBERT DIANE M, WEINSTEIN BRADLEY F. Biofilm as a risk factor in implant treatment. Periodontol 2000, 2019, 81(1): 29-40. DOI URL
[4]	DE WAAL Y C, EIJSBOUTS H V, WINKEL E G, et al. Microbial characteristics of peri-implantitis: a case-control study. J. Periodontol, 2017, 88(2): 209-217. DOI URL
[5]	DE AVILA ERICA DORIGATTI, LIMA BRUNO P, SEKIYA TAKEO, et al. Effect of UV-photofunctionalization on oral bacterial attachment and biofilm formation to titanium implant material. Biomaterials, 2015, 67: 84-92. DOI URL
[6]	SOBOLEV ALEXANDER, VALKOV ANTON, KOSSENKO ALEXEY, et al. Bioactive coating on Ti alloy with high osseointegration and antibacterial nanoparticles. ACS Appl. Mater. Interfaces, 2019, 11(43): 39534-39544. DOI URL
[7]	YUAN ZHANG, TAO BAILONG, HE YE, et al. Remote eradication of biofilm on titanium implant via near-infrared light triggered photothermal/photodynamic therapy strategy. Biomaterials, 2019, 223: 119479. DOI URL
[8]	ALQATTAN M, PETERS L, YANG F, et al. Microstructure, mechanical behaviour and antibacterial activity of biomedical Ti-xMn-yCu alloys. J. Alloys Compd., 2021, 856: 158165. DOI URL
[9]	DIEFENBECK M, SCHRADER C, GRAS F, et al. Gentamicin coating of plasma chemical oxidized titanium alloy prevents implant-related osteomyelitis in rats. Biomaterials, 2016, 101: 156-164. DOI URL
[10]	LI BAOE, ZHANG LEI, WANG DONGHUI, et al. Thermosensitive-hydrogel-coated titania nanotubes with controlled drug release and immunoregulatory characteristics for orthopedic applications. Mat. Sci. Eng. C-Mater., 2021, 122: 111878. DOI URL
[11]	KUMAR RAJESH, UMAR AHMAD, KUMAR GIRISHE, et al. Antimicrobial properties of ZnO nanomaterials: a review. Ceram. Int., 2017, 43(5): 3940-3961. DOI URL
[12]	YU FEN, FANG XUAN, JIA HUIMIN, et al. Zn or O? An atomic level comparison on antibacterial activities of zinc oxides. Chemistry, 2016, 22(24): 8053-8058.
[13]	ZHU LIYUAN, YUAN KAIPING, YANG JIAHE, et al. Hierarchical highly ordered SnO₂ nanobowl branched ZnO nanowires for ultrasensitive and selective hydrogen sulfide gas sensing. Microsystems & Nanoengineering, 2020, 6(1): 30-43.
[14]	JIAN SHENGRUI, LEE YAHUI. Nanoindentation-induced interfacial fracture of ZnO thin films deposited on Si(111) substrates by atomic layer deposition. J. Alloys Compd., 2014, 587: 313-317. DOI URL
[15]	TAPILY K, GU D, BAUMGART H, et al. Mechanical and structural characterization of atomic layer deposition-based ZnO films. Semicond. Sci. Tech., 2011, 26(11): 115005. DOI URL
[16]	LUO QIMING, CAO HUILIANG, WANG LANYU, et al. ZnO@ZnS nanorod-array coated titanium: good to fibroblasts but bad to bacteria. J. Colloid. Interface Sci., 2020, 579: 50-60. DOI URL
[17]	BAKHORI SITI KHADIJAH MOHD, MAHMUD SHAHROM, MASUDI SAM’AN MALIK, et al. Cytotoxicity evaluation of ZnO-eugenol (ZOE) using different ZnO structure on human gingival fibroblast. AIP Conference Proceedings, 2017, 1865(1): 020008.
[18]	JORDAHL STACY, SOLORIO LUIS, NEALE DYLAN B, et al. Engineered fibrillar fibronectin networks as three-dimensional tissue scaffolds. Adv. Mater., 2019, 31(46): 1904580. DOI URL
[19]	MCWHORTER FRANCES Y, WANG TINGTING, NGUYEN PHOEBE, et al. Modulation of macrophage phenotype by cell shape. Proc. Natl. Acad. Sci. U S A, 2013, 110(43): 17253-17258. DOI URL
[20]	LI JUN, TAN LEI, LIU XIANGMEI, et al. Balancing bacteria-osteoblast competition through selective physical puncture and biofunctionalization of ZnO/polydopamine/arginine- glycine-aspartic acid-cysteine nanorods. ACS Nano, 2017, 11(11): 11250-11263. DOI URL
[21]	JIAN XIAOCHONG, HUANG WENXIU, WU DONG, et al. Effect of fibronectin-coated micro-grooved titanium surface on alignment, adhesion, and proliferation of human gingival fibroblasts. Med. Sci. Monitor., 2017, 23: 4749-4759. DOI URL
[22]	KRÓL A, POMASTOWSKI P, RAFIŃSKA K, et al. Zinc oxide nanoparticles: synthesis, antiseptic activity and toxicity mechanism. Adv. Colloid. Interface Sci., 2017, 249: 37-52. DOI URL
[23]	KOUTOUZIS THEOFILOS, EASTMAN CHRISTIE, CHUKKAPALLI SASANKA, et al. A novel rat model of polymicrobial peri-implantitis: a preliminary study. J. Periodontol., 2017, 88(2): e32-e41. DOI URL
[24]	YAMAZAKI SEIYA, MASAKI CHIHIRO, NODAI TOMOTAKA, et al. The effects of hyperglycaemia on peri-implant tissues after osseointegration. J. Prosthodont Res., 2020, 64(2): 217-223. DOI URL